rs4783575 chr16:66357614 A>G
- Sequence
ttcctcttcccacgtgtgtcctcc[A/G]ggagccccgtcttgccaagtccag
- ASB in cell types
- glioblastoma cells HMEC (human mammary epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -1.36 | 1.03 | 1.33 | |||
| HMEC (human mammary epithelial cells) | 1.75 | -0.46 | 1.25 |
Items per page:
1 – 2 of 2