rs4784047 chr16:51982808 C>T
- Sequence
caaataacctttgaaaacctgctt[C/T]taggtgtttatgtgtcaggacagt
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.24 | -1.25 | 2.00 | 0.37 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, height, major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females)