rs4784651 chr16:56277862 G>A
- Sequence
cacacggtgtgtgagatcttccag[G/A]agcaaatgtattcatctcccagcc
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZSCA4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZSCA4_HUMAN | 3.29 | n/a | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol, ldl cholesterol change with statins, total cholesterol change with statins, waist hip ratio in controls
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Testis