rs4785839 chr16:65576855 G>A
- Sequence
tgtgtttgtgcatgagggggcgct[G/A]ttggtgctagaaggagccttagac
- ASB in cell types
- WA01 (H1, human embryonic stem cells) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| WA01 (H1, human embryonic stem cells) | 1.14 | 0.05 | 1.08 | |||
| foreskin keratinocyte | 2.20 | n/a | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, adiponectin levels, chronic kidney disease, hdl cholesterol change with statins, sporadic creutzfeldt-jakob disease, total cholesterol, waist hip ratio