rs4786599 chr16:5097513 G>C
- Sequence
ccccagggacggggaccgggtcgc[G/C]cggccctgaccggcgggagcccag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma) K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.12 | 0.43 | 1.18 | |||
| HepG2 (hepatoblastoma) | 1.16 | 0.06 | 2.83 | |||
| K562 (myelogenous leukemia) | 0.93 | 0.15 | 2.00 | |||
| HEK293 (embryonic kidney) | 0.14 | 0.95 | 1.97 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Nerve_Tibial, Pancreas, Prostate, Small_Intestine_Terminal_Ileum, Spleen, Thyroid