rs4788585 chr16:71959739 A>G
- Sequence
ataaaaagaattagaagaggaaga[A/G]gaggaacagaagcaggaagtggaa
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 0.17 | 0.95 | 1.27 | 2.85 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP birth weight, eur students <30 delayed story recall, eur students <30 immediate story recall, hdl cholesterol, height, hip bone mineral density (bmd), homa-b, ldl cholesterol, primary rhegmatogenous retinal detachment, total cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood