rs4788921 chr17:76365806 T>C
- Sequence
aagagggaccataagggaggatca[T/C]ttgagcccaggagtttgaggctgc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM19239 (male B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 1.84 | -1.27 | 2.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -1.92 | 2.06 | 1.00 | |||
| GM02630 (Fanconi anemi) | 1.72 | -1.33 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Thyroid