rs4789283 chr17:76365730 C>T
- Sequence
cttgtctcaaaacaaacaaacaaa[C/T]aaaaaaatttaaaaattagctggg
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM19239 (male B-cells lymphoblastoid cell line) GM02630 (Fanconi anemi) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | 2.06 | n/a | 2.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -2.14 | 2.07 | 1.00 | |||
| GM02630 (Fanconi anemi) | 1.03 | -0.61 | 1.00 | |||
| pancreas | -0.12 | 2.31 | 1.00 |
Items per page:
1 – 4 of 4