rs4789504 chr17:77839563 C>T
- Sequence
tggctaccatggactgatttgacc[C/T]agggaccgttgtttgccaacagct
- ASB in cell types
- breast tumor
- ASB for transcription factors
- ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.23 | -1.15 | 2.00 | 1.10 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, hdl cholesterol change with statins, hypertension (early onset hypertension), tetrology of fallot