rs4789523 chr17:78016773 C>T
- Sequence
ggaggaggattattatactataaa[C/T]gcttactgtgtactaagtgccagt
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.06 | -2.03 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. alzheimers disease without psychotic symptoms), alzheimers disease with psychotic symptoms (alzheimers disease with psychotic symptoms v. controls), b-other acute lymphoblastic leukemia, bipolar disorder, comorbid depressive syndrome and alcohol dependence, crohns disease, irritible bowel syndrome, ldl cholesterol, mitral annular calcium, resistance to kuru in aged women despite likely exposure, severe diabetic retinopathy, sporadic creutzfeldt-jakob disease, triglycerides change with statins, urinary albumin-to-creatinine ratio