rs4789577 chr17:78324754 C>T
- Sequence
gttgtgtgtgcggcacctcctcct[C/T]ctgggcccgggcttcggggaggaa
- ASB in cell types
- macrophages form periferal blood CTV-1 (Adult T acute lymphoblastic leukemia) EOL-1 (Acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | -4.97 | 2.18 | 2.00 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 1.21 | 0.46 | 1.00 | |||
| EOL-1 (Acute myeloid leukemia) | 1.31 | 0.03 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), diastolic blood pressure (dbp), hdl cholesterol, height, ldl cholesterol, triglycerides