rs4790733 chr17:1630244 T>C
- Sequence
agacaacgcttggagctgtcagcc[T/C]gctggggggcggctccagctggta
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM02255 (Lymphoblastoid Cell Lines) CD14+ monocytes GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- CTCF_HUMAN STAT1_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.55 | 0.93 | 1.31 | 3.75 | Concordant | |||
| STAT1_HUMAN | 2.38 | -0.47 | 2.00 | n/a | No Hit | |||
| STAG1_HUMAN | 0.07 | 0.64 | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), ldl cholesterol change with statins, stabilized warfarin dose, total cholesterol change with statins, triglycerides