rs4790957 chr17:65198715 T>G
- Sequence
agtacccagccctgggggcatcac[T/G]cctgagccttgacactcagctgct
- ASB in cell types
- thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | 1.55 | -1.18 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (females), systolic blood pressure (sbp)