rs4791118 chr17:67779156 T>G
- Sequence
acctttccctctccggaagagcca[T/G]tagcgccccctgctgcctgagccg
- ASB in cell types
- HCT-116 (colon carcinoma) GM19239 (male B-cells lymphoblastoid cell line) GM02610 (Lymphoblastoid Cell Lines) foreskin keratinocyte
- ASB for transcription factors
- RAD21_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RAD21_HUMAN | 1.40 | -0.00 | 1.61 | n/a | n/a | |||
| STAG1_HUMAN | 1.32 | 0.58 | 1.07 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid