rs4791331 chr17:9028765 C>T
- Sequence
aacattgtattcttaatagacttt[C/T]atgtttacacttcaaatgtccact
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.77 | -0.31 | 1.75 | 1.43 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP bipolar disorder, cleft lip, with or without cleft palate, cleft lip, with or without cleft palate, in asian ancestry population, refractive error