rs4792315 chr17:13018031 G>C
- Sequence
caccacctagccgctccgcatggc[G/C]gatccagccaatcagcgcgccgtg
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) GM12878 (female B-cells lymphoblastoid cell line) breast tumor adult erythroblasts
- ASB for transcription factors
- TCF21_HUMAN ESR1_HUMAN EP300_HUMAN FOXK2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.53 | n/a | 2.50 | n/a | No Hit | |||
| ESR1_HUMAN | 3.36 | -0.56 | 2.00 | n/a | No Hit | |||
| EP300_HUMAN | 2.61 | -2.35 | 1.00 | n/a | n/a | |||
| FOXK2_HUMAN | 3.11 | 0.51 | 1.67 | n/a | No Hit | |||
| HCFC1_HUMAN | 1.97 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood