rs4792358 chr17:13416196 G>A
- Sequence
tccaaacccaagcagcccaaatcc[G/A]gggcccttacatgtggacttcatc
- ASB in cell types
- HepG2 (hepatoblastoma) HASM2 (Human airway smooth muscle 2)
- ASB for transcription factors
- ARI4B_HUMAN NR2F6_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI4B_HUMAN | 2.36 | -2.38 | 1.00 | n/a | n/a | |||
| NR2F6_HUMAN | 1.99 | -0.33 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, mitral annular calcium, tetrology of fallot, total cholesterol change with statins, waist hip ratio