rs4792748 chr17:16453320 G>A
- Sequence
aaacacacacacacacgcacacac[G/A]cacacacgcacacgcacacacgca
- ASB in cell types
- bipolar neuron HCM (cardiac myocytes)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 1.98 | -1.11 | 1.25 | |||
| HCM (cardiac myocytes) | 2.47 | n/a | 1.00 |
Items per page:
1 – 2 of 2