rs4793636 chr17:50062136 G>A
- Sequence
ccagtcctgatgccacaacaaatc[G/A]gaacaacaatgctcacattagcta
- ASB in cell types
- BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 0.29 | 1.17 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, ldl cholesterol, obesity with early age of onset (age >2), paternal transmission distortion, systolic blood pressure (sbp), total cholesterol, waist hip ratio
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Colon_Transverse, Lung, Nerve_Tibial, Thyroid