rs4794268 chr17:51585549 C>G
- Sequence
cttaatttaaaggatttaaaaact[C/G]attctagagctaaataatttacag
- ASB in cell types
- bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | 1.41 | -1.41 | 1.00 | |||
| IPSC-derived bipolar neuron | 1.63 | -0.91 | 1.00 |
Items per page:
1 – 2 of 2