rs4794872 chr17:27282071 G>C
- Sequence
tccacgaagcacatgaactcaagt[G/C]agaaagaaaggtttcaattctgac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TBX21_HUMAN | 2.17 | -1.74 | 1.00 | -4.71 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, height, infant head circumference, ldl cholesterol, microalbuminuria, total cholesterol, urinary albumin-to-creatinine ratio
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Thyroid, Whole_Blood