rs4795655 chr17:31826198 G>A
- Sequence
gcctagggccagcacagatgtcac[G/A]tcctcctgccagtactgacagttc
- ASB in cell types
- HKC8 (kidney proximal tubule cell line)
- ASB for transcription factors
- E2F8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| E2F8_HUMAN | 2.27 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood