rs4796093 chr17:35519585 G>A
- Sequence
ctacatcctctctccccacatcaa[G/A]gaagtggcacttcaatccccaccc
- ASB in cell types
- LHSAR (prostate epithelial cells) CFPAC-1(pancreatic ductal adenocarcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | 2.30 | 0.45 | 2.00 | 0.32 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP depression scale of the revised neo personality inventory, obesity with early age of onset (age >2), resistance to kuru in aged women despite likely exposure