rs4796926 chr18:11500611 C>T
- Sequence
aaactagaggtcacagctgtgccc[C/T]agggcagtcctgcccaaagctact
- ASB in cell types
- RPMI8226 (Plasma cell myeloma) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RPMI8226 (Plasma cell myeloma) | -4.67 | 2.91 | 1.50 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.18 | -4.41 | 2.50 |
Items per page:
1 – 2 of 2