rs4798617 chr18:839546 A>T
- Sequence
gtggtcaaaactggcagtgccgtt[A/T]gcgggctcagcgggacgtgagaac
- ASB in cell types
- K562 (myelogenous leukemia) Kelly (neuroblastoma) HCASMC (Human coronary artery smooth muscle cells) upper lobe of left lung
- ASB for transcription factors
- TCF21_HUMAN MTG16_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TCF21_HUMAN | 2.25 | n/a | 2.00 | n/a | No Hit | |||
| MTG16_HUMAN | -1.79 | 2.33 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2