rs4799311 chr18:31646481 G>A
- Sequence
atgacttcactgttagaacaggat[G/A]taaaaggctattgaaactacagat
- ASB in cell types
- GM12891 (male B- cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line) GM12890 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12891 (male B- cells lymphoblastoid cell line) | 1.25 | -0.38 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.78 | -1.49 | 1.00 | |||
| GM12890 (Lymphoblastoid Cell Lines) | -1.66 | 2.18 | 1.00 |
Items per page:
1 – 3 of 3