rs4799840 chr18:36018092 C>A
- Sequence
aactgcatgccttgaacacacagc[C/A]cacttaagactttttaagtactgg
- ASB in cell types
- foreskin keratinocyte pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.99 | -3.25 | 2.67 | |||
| pancreas | -1.81 | 2.20 | 1.00 |
Items per page:
1 – 2 of 2