rs4800451 chr18:23136841 C>T
- Sequence
cccagcattcgcagaggagcaccg[C/T]gcttgtgcagtgggtcgggaattg
- ASB in cell types
- HS-SY-2(Monophasic synovial sarcoma) GM02610 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HS-SY-2(Monophasic synovial sarcoma) | 1.10 | -0.11 | 1.00 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -0.53 | 1.66 | 1.00 |
Items per page:
1 – 2 of 2