rs4800935 chr18:54679997 A>G
- Sequence
aaagtgtgttttacttacaaagat[A/G]agcaaatatgaaactttcaaaaaa
- ASB in cell types
- foreskin keratinocyte GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 2.89 | -3.77 | 2.50 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -2.04 | 1.23 | 1.33 |
Items per page:
1 – 2 of 2