rs4802210 chr19:44141595 A>G
- Sequence
ttccgctccagggaagagggggcg[A/G]ttgtcacggcacattccacggtag
- ASB in cell types
- macrophages form periferal blood MOLT-4 (Adult T acute lymphoblastic leukemia) BJ1-hTERT (Human fibroblast telomerase immortalized cell line) Tet21N (neuroblastoma)
- ASB for transcription factors
- CDK9_HUMAN EGR1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK9_HUMAN | -0.40 | 1.76 | 1.00 | n/a | n/a | |||
| EGR1_HUMAN | 0.19 | 1.99 | 1.00 | 1.69 | Weak Concordant | |||
| CTCF_HUMAN | 0.27 | 1.21 | 1.24 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight, height, maternal transmission distortion, triglycerides
GTEx eQTL Adrenal_Gland, Artery_Tibial, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Testis, Thyroid, Whole_Blood