rs4802723 chr19:50669529 A>G
- Sequence
aaggtgaggaaactgaaattcagc[A/G]gaacttcctccccacgccaggagg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) erythroid progenitors HeLa Kyoto (cervical adenocarcinoma) neutrophils
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.22 | 1.00 | 1.00 | |||
| erythroid progenitors | 1.93 | n/a | 2.50 | |||
| HeLa Kyoto (cervical adenocarcinoma) | -0.04 | 1.73 | 2.00 | |||
| neutrophils | 2.17 | 0.80 | 1.50 | |||
| HMEC (human mammary epithelial cells) | -0.58 | 1.22 | 1.00 |
Items per page:
1 – 5 of 9