rs4803898 chr19:46125138 G>C
- Sequence
gtctctggaaatgtcaaggggacc[G/C]tttatgaagccactttattttttg
- ASB in cell types
- THP-1 (acute monocytic leukemia) macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| THP-1 (acute monocytic leukemia) | 2.00 | -0.19 | 1.33 | |||
| macrophages form periferal blood | -4.63 | 2.32 | 2.00 |
Items per page:
1 – 2 of 2