rs4803913 chr19:46265496 A>G
- Sequence
tttcagcccagcagggtggctcac[A/G]cctgtaatcccagacctttggaag
- ASB in cell types
- erythroid cells HeLa (cervical adenocarcinoma)
- ASB for transcription factors
- ZN335_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN335_HUMAN | n/a | 2.09 | 2.00 | 2.91 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), infant head circumference, irritible bowel syndrome, ldl cholesterol