rs4804044 chr19:47284247 G>A
- Sequence
aggacctgtgtcaaaaaagtatgc[G/A]tgcatgtctagttgagtctgtgtg
- ASB in cell types
- PC9 (lung adenocarcinoma) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| PC9 (lung adenocarcinoma) | 1.79 | -1.07 | 1.00 | |||
| HEK293 (embryonic kidney) | 0.60 | 0.21 | 1.68 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood