rs4804386 chr19:8988377 C>T
- Sequence
acaagtgccccctgctggccaatc[C/T]ttttagtttatcttcttgtatgta
- ASB in cell types
- bipolar neuron GM23338 H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| bipolar neuron | -1.97 | 2.36 | 1.00 | |||
| GM23338 | -1.28 | 1.61 | 1.33 | |||
| H929 (plasma cell myeloma) | n/a | 1.85 | 2.00 |
Items per page:
1 – 3 of 3