rs4804550 chr19:10960719 C>T
- Sequence
gtggcgtccgctctgcgcatgctc[C/T]ggggcgtcaagacgcgaggcgtgc
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- CTCF_HUMAN TYY1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.85 | 1.10 | 1.10 | n/a | No Hit | |||
| TYY1_HUMAN | 2.45 | 0.03 | 1.71 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg