rs4804551 chr19:10960884 G>T
- Sequence
cgcgcgccgggagcggaagggcgg[G/T]ctggcgcgcgcacgaggccgggca
- ASB in cell types
- fetal bone marrow-derived mononuclear cells HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fetal bone marrow-derived mononuclear cells | 1.93 | -1.64 | 1.00 | |||
| HepG2 (hepatoblastoma) | 0.31 | 0.94 | 1.18 |
Items per page:
1 – 2 of 2