rs4805440 chr19:29597240 C>T
- Sequence
tttaaaccacttgactctgtcctg[C/T]ctattctggaggtgttgatcaaaa
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells lymphoblastoid cell line) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.23 | 0.46 | 4.63 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 1.40 | 0.89 | 1.08 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 0.03 | 1.97 | 1.00 |
Items per page:
1 – 3 of 3