rs4805474 chr19:29760063 T>G
- Sequence
aaaaaacaaaaaaagttgccattg[T/G]ggtccccctttctccagcctggcc
- ASB in cell types
- HEK293 (embryonic kidney) Peyer's patch
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.07 | 0.37 | 4.58 | |||
| Peyer's patch | 2.47 | -2.17 | 1.00 |
Items per page:
1 – 2 of 2