rs4805993 chr19:34146127 A>T
- Sequence
gcttaaacaactttcactgtagta[A/T]gttggtttggttaaaaactatcat
- ASB in cell types
- A549 (lung carcinoma) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 0.09 | 1.07 | 1.94 | |||
| SK-N-SH (neuroblastoma) | 1.33 | -1.33 | 1.00 |
Items per page:
1 – 2 of 2