rs4806711 chr19:54115811 G>A
- Sequence
ggagaggagaggtgagtgtgatgg[G/A]gaccacggggagcgggaggctggg
- ASB in cell types
- germinal center B-cells adult erythroblasts
- ASB for transcription factors
- KMT2B_HUMAN KDM6A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KMT2B_HUMAN | 1.37 | 3.02 | 1.33 | n/a | No Hit | |||
| KDM6A_HUMAN | -0.80 | 1.74 | 1.50 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood