rs4807000 chr19:4831866 A>G
- Sequence
ccgcacccatgcgctctcttccca[A/G]cccttgcggtcacgttcagcaagt
- ASB in cell types
- HAEC (human aortic endothelial cells) GM12891 (male B- cells lymphoblastoid cell line) prostate gland
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HAEC (human aortic endothelial cells) | n/a | 2.02 | 2.00 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 1.72 | 0.11 | 1.00 | |||
| prostate gland | -2.02 | 2.17 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Prostate, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood