rs4807542 chr19:1104079 G>A
- Sequence
ccgcctttgccgcctactgaagcc[G/A]gcgctgctctgtggggctctggcc
- ASB in cell types
- K562 (myelogenous leukemia) CD14+ monocytes WA09 (embryonic stem cells) breast tumor
- ASB for transcription factors
- STAT1_HUMAN TP53B_HUMAN ESR1_HUMAN RFOX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | 2.43 | -3.65 | 2.00 | n/a | No Hit | |||
| TP53B_HUMAN | 2.75 | -2.55 | 1.00 | n/a | n/a | |||
| ESR1_HUMAN | 2.15 | -0.39 | 2.00 | n/a | No Hit | |||
| RFOX2_HUMAN | -3.14 | 1.75 | 2.00 | n/a | n/a | |||
| VEZF1_HUMAN | -1.54 | 2.49 | 2.00 | n/a | No Hit |
Items per page:
1 – 5 of 6
Motif analysis
No data available
Genetic associations
EMBL-EBI eosinophil counts, eosinophil percentage of granulocytes, eosinophil percentage of white cells, nasal polyps, neutrophil percentage of granulocytes, sum eosinophil basophil counts
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Vagina, Whole_Blood