rs4807626 chr19:4731079 A>G
- Sequence
ccattgctcactctgctcctcctc[A/G]ctgttcctccaacacaccaggtga
- ASB in cell types
- HEK293 (embryonic kidney) GM19193 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.05 | 0.76 | 1.95 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | -1.54 | 2.12 | 1.00 |
Items per page:
1 – 2 of 2