rs4807874 chr19:6516481 G>A
- Sequence
gtgggaggcggatgacagcggaat[G/A]gggcttcggtagactgacaggatc
- ASB in cell types
- K562 (myelogenous leukemia) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- STAG1_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.18 | -0.64 | 1.00 | n/a | n/a | |||
| ETS1_HUMAN | -0.91 | 1.71 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, homa-b, microalbuminuria, obesity with early age of onset (age >2), rheumatoid arthritis