rs4808032 chr19:16077745 A>G
- Sequence
cgtggagcctggcgctttgtaaat[A/G]atcaattgtgttgttgttttttgt
- ASB in cell types
- OCI-LY7 (diffuse large B-cell lymphoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXP1_HUMAN | 2.69 | -2.48 | 1.00 | -3.60 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
