rs4809588 chr20:46349382 G>T
- Sequence
gagtggaaagcccaagccccaggg[G/T]cccatgaagttccaggaggctgtg
- ASB in cell types
- GM18486 (Lymphoblastoid Cell Lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18486 (Lymphoblastoid Cell Lines) | -0.90 | 1.33 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 1.34 | -0.85 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Brain_Cortex, Esophagus_Muscularis, Skin_Not_Sun_Exposed_Suprapubic