rs4809795 chr20:50459145 A>G
- Sequence
taaatgggtggatggatggatgga[A/G]ggaaggatggatggatggatggat
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.32 | 0.57 | 4.06 | |||
| pancreas | 2.36 | -2.38 | 1.00 |
Items per page:
1 – 2 of 2