rs4809914 chr20:52675421 G>T
- Sequence
ggcaaatatgcaaaggacactcag[G/T]tatgaaaatcacccctcctccacg
- ASB in cell types
- Kasumi-1 (acute myeloblastic leukemia)
- ASB for transcription factors
- CEBPA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPA_HUMAN | n/a | 2.89 | 1.50 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), body mass index (bmi), hdl cholesterol, homa-b, suicide attempts in bipolar disorder (females), triglycerides, urinary albumin-to-creatinine ratio, waist hip ratio