rs4810296 chr20:40563677 C>T
- Sequence
atcctaaaggcagcggccaggcta[C/T]tgaagatttgagagttggttggtg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.29 | 1.71 | 1.68 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (geographic atrophy), birth weight, childhood acute lymphoblastic leukemia, fasting insulin, ldl cholesterol, lp-pla2 activity, total cholesterol, triglycerides